Review

mission shrna library (Millipore)

Millipore is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Millipore mission shrna library
Mission Shrna Library, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mission+shrna+library/non+targeting+shrna/pm39180751-202-274-275
Average 90 stars, based on 1 article reviews

mission shrna library - by Bioz Stars, 2026-09

90/100 stars

Images

shRNA:

Article Title: Acquisition of taxane resistance by p53 inactivation in ovarian cancer cells.
Article Snippet: Ovarian cancer is one of the most common gynecologic malignancies in women and has a poor prognosis.. Taxanes are a class of standard first-line chemotherapeutic agents for the treatment of ovarian cancer.. However, tumor-intrinsic and acquired resistance to taxanes poses major challenges to improving clinical outcomes.

Article Title: The transcriptional regulatory network modulating human trophoblast stem cells to extravillous trophoblast differentiation.
Article Snippet: .. Bacterial stocks containing lentiviral shRNA for a target gene were purchased from MilliporeSigma (MISSION shRNA library, Supplementary Data 7). .. Lentiviral vector carrying shRNA for KD or non-target sequence (MilliporeSigma, SHC202) was transfected to HEK293T cells at 70% confluency using GenJetTM In Vitro DNA Transfection Reagent (SignaGen Laboratories, SL100488), according to the manufacturer’s instructions.

Article Title: Oncogenic RAS commandeers amino acid sensing machinery to aberrantly activate mTORC1 in multiple myeloma.
Article Snippet: .. Gene Ontogeny Biological Process and Pathway analysis were used with the indicated gene lists and log2fc values. shRNA and sgRNA mediated knockdown Individual shRNAs were obtained from the MISSION shRNA Library from the RNAi Consortium TRC1.0 in the pLKO.1 vector (SIGMA): shCTRL GCCAAGATTCAGAATCCCAAA shNRAS.1 GAAACCTGTTTGTTGGACATA shNRAS.2 CAGTGCCATGAGAGACCAATA shKRAS.1 GCAGACGTATATTGTATCATT shKRAS.2 GAGGGCTTTCTTTGTGTATTT shSLC3A2.1 CGAGAAGAATGGTCTGGTGAA shSLC3A2.2 GCTGGGTCCAATTCACAAGAA shRPTOR.1 CCTCACTTTATTTCCATGTAA shRPTOR.2 CGAGTCCTCTTTCACTACAAT shRICTOR.1 GCACCCTCTATTGCTACAATT shRICTOR.2 CGTCGGAGTAACCAAAGATTA sgCTRL TTGCAATGCTGCTATAGAAG sgTSC2 CAGCATCTCATACACACGCG Lentiviral transductions of shRNAs were performed as described above. .. Transduced MM cells were selected with 1μg/ml puromycin (Gibco) for 2 days before either western blot analysis or proximity ligation. mNeonGreen fusions For co-immunoprecipitation and imaging studies, mutant RAS isoforms of KRASG12D, KRASS17N, NRASG12D, NRASQ61L and NRASS17N were linked to mNeonGreen as gene fragments (Twist Biosciences).

Article Title: In Vivo Screening Unveils Pervasive RNA-Binding Protein Dependencies in Leukemic Stem Cells and Identifies ELAVL1 as a Therapeutic Target.
Article Snippet: Guy Sauvageau, University of Montreal) with addition of AclI/AgeI restriction sites (NEB; cat. no. R0598S/R3552S) and subsequent subcloning into AclI/AgeI digested pZIP. .. These ELAVL1 shRNAs (5′-TTGTTAGTGTACAACTCATTT-3′ and 5′-GCAGCAT TGGTGAAGTTGAAT-3′) were adapted from the MISSION shRNA library (MilliporeSigma). .. Annealed oligos were digested with FastDigest XhoI/EcoRI restriction enzymes (Thermo Fisher Scientific; cat. no. FD0694/FD0274) and cloned into the pZIP-mCMV vector.

Knockdown:

other:

Article Title: A molecular brake that modulates spliceosome pausing at detained introns contributes to neurodegeneration
Article Snippet: Cell transfection was performed using Lipofectamine 3000 (Thermo Fisher Scientific). shRNA clones were purchased from lentiviral vector-based shRNA libraries (MISSION shRNA library, Sigma-Aldrich).

Article Title: The transcriptional regulatory network modulating human trophoblast stem cells to extravillous trophoblast differentiation
Article Snippet: Bacterial stocks containing lentiviral shRNA for a target gene were purchased from MilliporeSigma (MISSION shRNA library, Supplementary Table 7).

Article Title: Immune suppression by human thymus-derived effector Tregs relies on glucose/lactate-fueled fatty acid synthesis.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Flow cytometry Stain buffer BD Biosciences Cat# 554656 Methyl tert-butyl ether (MTBE) Honeywell Riedel-de Haen Cat# 34875 Sodium pyruvate (100 mM) Gibco Cat# 1136-039 L-glutamine (200 mM) Gibco Cat# 25030-024 D-glucose Merck Cat# 108337 Sodium L-lactate Sigma-Aldrich Cat# 71718 tetrahydro-4-methylene-2R-octyl5-oxo-3S-furancarboxylic acid (C75) Cayman Chemical Cat# 10005270 [U-13C6]-glucose Cambridge Isotopes Cat# CLM-1396 [U-13C3]-L-lactate Sigma-Aldrich Cat# 746258 Sodium sulfate Fluka Cat# 71961 N-tert-Butyldimethylsilyl-Nmethyltrifluoroacetamide (MTBSTFA) Sigma-Aldrich Cat# 77626 N-methyl-N-trimethylsilyltrifluoroacetamide (MSTFA) containing 1% Chlorotrimethylsilane Thermo Scientific Cat# TS-48915 N-trimethylsilyl-imidazole Sigma-Aldrich Cat# 394874 Opti-MEM Gibco 11058–021 Polyethylenimine (PEI) Polysciences Cat# 23966-1 Puromycin dihydrochloride Sigma-Aldrich Cat# P7255 Radioimmunoprecipitation assay (RIPA) buffer Thermo Scientific Cat# 89900 Protease inhibitor cocktail Roche Cat# 11836153001 NuPAGETM LDS sample buffer Invitrogen Cat# NP0007 NuPAGETM 10% Bis-Tris gel Invitrogen Cat# NP0301BOX NuPAGETM MES SDS Running Buffer Invitrogen Cat# NP0002 Roche Western blocking reagent Sigma-Aldrich Cat# 11921673001 Western BLoT Immuno Booster Takara Cat# T7115A BamHI-HF restriction enzyme New England Biolabs Cat# R3136S NotI-HF restriction enzyme New England Biolabs Cat# R3189S SalI-HF restriction enzyme New England Biolabs Cat# R3138S XbaI restriction enzyme New England Biolabs Cat# R0145S Critical commercial assays StraightFrom Buffy Coat CD4 MicroBead kit Miltenyi Biotec Cat# 130-114-980 FOXP3 transcription factor staining buffer set Invitrogen Cat# 00-5523-00 Intracellular fixation & permeabilization kit Invitrogen Cat# 88-8824-00 Pierce BCA Gold protein assay Thermo Scientific Cat# A53225 TMTproTM 16plex label reagent set Thermo Scientific Cat# A44520 Deposited data RNA-seq data GEO; De Kivit et al.,30 Mensink et al.43 Accession code GSE138604 Proteomics data ProteomeXchange Accession code PXD048504 Experimental models: Cell lines HEK293T cells Netherlands Cancer Institute, Amsterdam, the Netherlands RRID:CVCL_0063 Jurkat J16 cells Netherlands Cancer Institute, Amsterdam, the Netherlands RRID:CVCL_0065 Recombinant DNA pLKO.1-shControl construct: SHC002 Sigma-Aldrich MISSION shRNA library pLKO.1-shFASN construct: TRCN0000003128 Sigma-Aldrich MISSION shRNA library (Continued on next page) 20 Cell Reports 43, 114681, September 24, 2024

Plasmid Preparation:

Image Search Results

Complex I function mediated by NDUFV1 is important for cell cycle progression in cancer cells. (A) Western blotting with the indicated antibodies in MDA‐MB‐231 cells after 48 h of treatment with siRNAs for the major catalytic subunits of the electron transport chain complexes (I, NDUFV1 ; II, SDHA ; III, UQCRFS1 ; IV, SURF1 ). Ctr, negative control siRNA. α‐Tubulin is the loading control. Silencing efficiency of each siRNA was evaluated based on the band intensity quantified by imagej software, which was normalized to that of α‐tubulin and shown relative to Ctr. Representative results from three independent experiments are shown. (B, C) Cell proliferation and viability (B, MDA‐MB‐231 and MCF7; C, JHH‐4 and HLF) after transfection with the indicated siRNAs for 72 h: NDU, NDUFV1 . Silencing efficiencies of siRNAs are indicated in Table . (D, E) Doxycycline (DOX)‐responsive (TetOFF) shRNA [NDU (NDFUV1) or NT (nontarget control) (Table )]‐expressing cells were obtained from MCF7 cells by lentiviral transduction of the constructs (Materials and methods). Cells were incubated for 48 h in the presence (+) or absence (−) of DOX (1.0 μg·mL −1 ) and NDUFV1 knockdown was validated by western blotting. Representative blots from three independent experiments are shown (D). Growth curve and doubling time. 2 × 10 4 cells were seeded in the presence or absence of DOX; the number of viable cells was counted on each culture day. Doubling time (DT) was calculated from the slope of the graph (E). (F) Cell cycle distribution of siRNA‐transfected MCF7 and MDA‐MB‐231 cells. Bars and plots represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. For statistical analysis, two‐tailed Student's t ‐test (C and F) and one‐way ANOVA Dunnett's multiple comparisons test among group (B and E) were used; ** P < 0.01.

Journal: Molecular Oncology

Article Title: Respiratory complex I‐mediated NAD + regeneration regulates cancer cell proliferation through the transcriptional and translational control of p21 Cip1 expression by SIRT3 and SIRT7

doi: 10.1002/1878-0261.13808

Figure Lengend Snippet: Complex I function mediated by NDUFV1 is important for cell cycle progression in cancer cells. (A) Western blotting with the indicated antibodies in MDA‐MB‐231 cells after 48 h of treatment with siRNAs for the major catalytic subunits of the electron transport chain complexes (I, NDUFV1 ; II, SDHA ; III, UQCRFS1 ; IV, SURF1 ). Ctr, negative control siRNA. α‐Tubulin is the loading control. Silencing efficiency of each siRNA was evaluated based on the band intensity quantified by imagej software, which was normalized to that of α‐tubulin and shown relative to Ctr. Representative results from three independent experiments are shown. (B, C) Cell proliferation and viability (B, MDA‐MB‐231 and MCF7; C, JHH‐4 and HLF) after transfection with the indicated siRNAs for 72 h: NDU, NDUFV1 . Silencing efficiencies of siRNAs are indicated in Table . (D, E) Doxycycline (DOX)‐responsive (TetOFF) shRNA [NDU (NDFUV1) or NT (nontarget control) (Table )]‐expressing cells were obtained from MCF7 cells by lentiviral transduction of the constructs (Materials and methods). Cells were incubated for 48 h in the presence (+) or absence (−) of DOX (1.0 μg·mL −1 ) and NDUFV1 knockdown was validated by western blotting. Representative blots from three independent experiments are shown (D). Growth curve and doubling time. 2 × 10 4 cells were seeded in the presence or absence of DOX; the number of viable cells was counted on each culture day. Doubling time (DT) was calculated from the slope of the graph (E). (F) Cell cycle distribution of siRNA‐transfected MCF7 and MDA‐MB‐231 cells. Bars and plots represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. For statistical analysis, two‐tailed Student's t ‐test (C and F) and one‐way ANOVA Dunnett's multiple comparisons test among group (B and E) were used; ** P < 0.01.

Article Snippet: Target sequences for nontargeting control and each gene were obtained from Mission shRNA library (Merck KGaA) (Table ). siRNA (FlexiTube siRNA) was purchased from Qiagen (Venlo, the Netherlands).

Techniques: Western Blot, Negative Control, Control, Software, Transfection, shRNA, Expressing, Transduction, Construct, Incubation, Knockdown, Standard Deviation, Two Tailed Test

NDUFV1 downregulation upregulates p21 Cip1 expression in cancer cells. (A–C) Cells were incubated with siRNAs for 48 h: NDU, siRNA for NDUFV1 ; Ctr, negative control siRNA. Western blotting with the indicated antibodies. Band intensities measured with ImageJ are shown as relative to the control (Ctr). Representative blots from three independent experiments are shown. α‐Tubulin and β‐actin are the loading controls (A). The mRNA levels of p21 Cip1 examined using quantitative reverse transcription PCR (qRT‐PCR). Values are relative to control (Ctr) (B). Cells were treated at 0 h with actinomycin D (1 μg·mL −1 ) and at each time point, the amount of p21 Cip1 mRNA was determined by qRT‐PCR. The percentages of remaining p21 Cip1 mRNA were graphed (value at 0 h was defined as 100%). The half‐life ( t 1/2 ) of mRNA was calculated from the slope of the graph (C). (D) Reporter activity assessed in NDUFV1 ‐silenced MCF7 cells with shRNA or siRNA as in A and Fig. . Cells were transfected and incubated with WWP reporter plasmids (Materials and methods) together with the internal control for 48 h. A ratio to the control (NT, Ctr) is shown. Trichostatin A (TSA, 0.5 μ m ) was used as positive control. RLU, relative luciferase units. (E, F) DOX‐responsive (TetOFF) shRNA‐expressing MCF7 cells as in Fig. were transfected with siRNA for p21 Cip1 or negative control siRNA (Ctr) in the presence (+) or absence (−) of DOX (1 μg·mL −1 ). After 48 h, knockdown effects were validated as in A. Band intensities are shown as relative to control (shNT/Ctr, DOX+). Representative blots from three independent experiments are shown. α‐Tubulin is the loading control (E). Cell proliferation and viability were assessed after 72 h of transfection (F). Bars and plots represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. Two‐tailed Student's t ‐test (B and C) and one‐way ANOVA following by Dunnett's multiple comparisons test among group (D and F); ** P < 0.01, n.s., not significance.

Journal: Molecular Oncology

doi: 10.1002/1878-0261.13808

Figure Lengend Snippet: NDUFV1 downregulation upregulates p21 Cip1 expression in cancer cells. (A–C) Cells were incubated with siRNAs for 48 h: NDU, siRNA for NDUFV1 ; Ctr, negative control siRNA. Western blotting with the indicated antibodies. Band intensities measured with ImageJ are shown as relative to the control (Ctr). Representative blots from three independent experiments are shown. α‐Tubulin and β‐actin are the loading controls (A). The mRNA levels of p21 Cip1 examined using quantitative reverse transcription PCR (qRT‐PCR). Values are relative to control (Ctr) (B). Cells were treated at 0 h with actinomycin D (1 μg·mL −1 ) and at each time point, the amount of p21 Cip1 mRNA was determined by qRT‐PCR. The percentages of remaining p21 Cip1 mRNA were graphed (value at 0 h was defined as 100%). The half‐life ( t 1/2 ) of mRNA was calculated from the slope of the graph (C). (D) Reporter activity assessed in NDUFV1 ‐silenced MCF7 cells with shRNA or siRNA as in A and Fig. . Cells were transfected and incubated with WWP reporter plasmids (Materials and methods) together with the internal control for 48 h. A ratio to the control (NT, Ctr) is shown. Trichostatin A (TSA, 0.5 μ m ) was used as positive control. RLU, relative luciferase units. (E, F) DOX‐responsive (TetOFF) shRNA‐expressing MCF7 cells as in Fig. were transfected with siRNA for p21 Cip1 or negative control siRNA (Ctr) in the presence (+) or absence (−) of DOX (1 μg·mL −1 ). After 48 h, knockdown effects were validated as in A. Band intensities are shown as relative to control (shNT/Ctr, DOX+). Representative blots from three independent experiments are shown. α‐Tubulin is the loading control (E). Cell proliferation and viability were assessed after 72 h of transfection (F). Bars and plots represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. Two‐tailed Student's t ‐test (B and C) and one‐way ANOVA following by Dunnett's multiple comparisons test among group (D and F); ** P < 0.01, n.s., not significance.

Techniques: Expressing, Incubation, Negative Control, Western Blot, Control, Reverse Transcription, Quantitative RT-PCR, Activity Assay, shRNA, Transfection, Positive Control, Luciferase, Knockdown, Standard Deviation, Two Tailed Test

Decrease in the NAD + /NADH ratio signals to upregulate p21 Cip1 expression when Complex I activity is silenced. (A) MCF7 cells constitutively expressing shNDUFV1 (NDU) #1 or #2 and nontarget control shRNA (NT) were established. Immediately after selection and confirmation of NDUFV1 knockdown by western blotting (GAPDH: the loading control), the cells were treated and extracted with detergents and subjected to Blue native PAGE followed by western blotting with anti‐NDUFV1 antibody (WB: NDUFV1) or in‐gel Complex I (CI) activity assay (Materials and methods). Representative results from two independent experiments are shown. (B–D) MCF7 cells were treated with siRNA (Ctr, control; NDU, NDUFV1 ) in the presence or absence of 1 m m β‐nicotinamide mononucleotide (NMN), and the NAD + /NADH ratio was evaluated after 24 h (B). The levels of protein (C) and mRNA (D) were examined after 48 h by western blotting and qRT‐PCR, respectively. Values are relative to control (Ctr/−). Representative blots from three independent experiments are shown. Arrow and arrowhead indicate the position of NDUFV1 and unknown contingent bands, respectively. α‐Tubulin is the loading control. (E–G) MCF7 cells were infected with DOX‐responsive lentivirus constructs (TetON) expressing Flag‐tagged native ( Lb NOX), mitochondrial‐targeted Lb NOX (mito Lb NOX), or control (Mock). After 48 h of transfection with siRNA with (+) or without (−) DOX (0.5 μg·mL −1 ), western blotting (E) and qRT‐PCR (G) were performed. Representative blots from three independent experiments are shown. β‐Actin is the loading control. Values are relative to control (Ctr/DOX−). The NAD + /NADH ratio was determined after treatment with siRNA for 24 h in the presence or absence of DOX (F). Bars represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. One‐way ANOVA with Bonferroni post hoc test among group; ** P < 0.01.

Journal: Molecular Oncology

doi: 10.1002/1878-0261.13808

Figure Lengend Snippet: Decrease in the NAD + /NADH ratio signals to upregulate p21 Cip1 expression when Complex I activity is silenced. (A) MCF7 cells constitutively expressing shNDUFV1 (NDU) #1 or #2 and nontarget control shRNA (NT) were established. Immediately after selection and confirmation of NDUFV1 knockdown by western blotting (GAPDH: the loading control), the cells were treated and extracted with detergents and subjected to Blue native PAGE followed by western blotting with anti‐NDUFV1 antibody (WB: NDUFV1) or in‐gel Complex I (CI) activity assay (Materials and methods). Representative results from two independent experiments are shown. (B–D) MCF7 cells were treated with siRNA (Ctr, control; NDU, NDUFV1 ) in the presence or absence of 1 m m β‐nicotinamide mononucleotide (NMN), and the NAD + /NADH ratio was evaluated after 24 h (B). The levels of protein (C) and mRNA (D) were examined after 48 h by western blotting and qRT‐PCR, respectively. Values are relative to control (Ctr/−). Representative blots from three independent experiments are shown. Arrow and arrowhead indicate the position of NDUFV1 and unknown contingent bands, respectively. α‐Tubulin is the loading control. (E–G) MCF7 cells were infected with DOX‐responsive lentivirus constructs (TetON) expressing Flag‐tagged native ( Lb NOX), mitochondrial‐targeted Lb NOX (mito Lb NOX), or control (Mock). After 48 h of transfection with siRNA with (+) or without (−) DOX (0.5 μg·mL −1 ), western blotting (E) and qRT‐PCR (G) were performed. Representative blots from three independent experiments are shown. β‐Actin is the loading control. Values are relative to control (Ctr/DOX−). The NAD + /NADH ratio was determined after treatment with siRNA for 24 h in the presence or absence of DOX (F). Bars represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. One‐way ANOVA with Bonferroni post hoc test among group; ** P < 0.01.

Techniques: Expressing, Activity Assay, Control, shRNA, Selection, Knockdown, Western Blot, Blue Native PAGE, Quantitative RT-PCR, Infection, Construct, Transfection, Standard Deviation

$Translation of p21 Cip1 is promoted by the downregulation of SIRT3 activity when Complex I activity is silenced. (A) Western blotting and qRT‐PCR with MCF7 cells transfected with siRNA for SIRT3 (silencing efficiency is indicated in Table ) or negative control siRNA (Ctr) for 48 h. Values are relative to control (Ctr). β‐Actin is the loading control. (B) Western blotting and qRT‐PCR with MCF7 cells expressing Flag‐tagged SIRT3 (Flag‐SIRT3) or control (Mock) after 48 h of transfection with NDUFV1 siRNA (NDU) or negative control siRNA (Ctr). Values are relative to control (Ctr). Arrowhead and arrow indicate exogenous and endogenous SIRT3, respectively. α‐Tubulin is the loading control. (C) MCF7 and MDA‐MB‐231 cells expressing DOX‐responsive (TetOFF) shRNA (Table ) were cultured for 72 h in the absence of DOX. After treatment with cycloheximide (100 μg·mL −1 ) for the indicated time, p21 Cip1 was quantified by western blotting. After normalization to α‐tubulin values, the remaining amounts were plotted (value at 0 h was defined as 100%). The half‐life ( t 1/2 ) of protein was calculated from the slope of the graph. α‐Tubulin is the loading control. (D) The acetylation levels of SOD2 (SOD2ac) were examined using western blotting in cells expressing Flag‐tagged SOD2 after 48 h of transfection with siRNA. The band intensity of SOD2ac was normalized to that of SOD2 and shown as relative to control (Ctr). α‐Tubulin and β‐actin are the loading controls. (E) MCF7 cells were transfected with the indicated siRNAs, and nascent protein synthesis was examined after 24 h (Materials and methods). The affinity‐purified fractions were examined using western blotting with the indicated antibodies. The band intensity of p21 Cip1 was normalized to that of β‐actin and shown as relative to control (Ctr). Representative results from three independent experiments are shown. β‐Actin is the loading control. In western blotting, representative blots from three independent experiments are shown. Bars and plots represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. Two‐tailed Student's t ‐test (A and C) and one‐way ANOVA following by Bonferroni multiple comparisons test among group (B); ** P < 0.01, n.s., not significance.$

Journal: Molecular Oncology

doi: 10.1002/1878-0261.13808

Figure Lengend Snippet: Translation of p21 Cip1 is promoted by the downregulation of SIRT3 activity when Complex I activity is silenced. (A) Western blotting and qRT‐PCR with MCF7 cells transfected with siRNA for SIRT3 (silencing efficiency is indicated in Table ) or negative control siRNA (Ctr) for 48 h. Values are relative to control (Ctr). β‐Actin is the loading control. (B) Western blotting and qRT‐PCR with MCF7 cells expressing Flag‐tagged SIRT3 (Flag‐SIRT3) or control (Mock) after 48 h of transfection with NDUFV1 siRNA (NDU) or negative control siRNA (Ctr). Values are relative to control (Ctr). Arrowhead and arrow indicate exogenous and endogenous SIRT3, respectively. α‐Tubulin is the loading control. (C) MCF7 and MDA‐MB‐231 cells expressing DOX‐responsive (TetOFF) shRNA (Table ) were cultured for 72 h in the absence of DOX. After treatment with cycloheximide (100 μg·mL −1 ) for the indicated time, p21 Cip1 was quantified by western blotting. After normalization to α‐tubulin values, the remaining amounts were plotted (value at 0 h was defined as 100%). The half‐life ( t 1/2 ) of protein was calculated from the slope of the graph. α‐Tubulin is the loading control. (D) The acetylation levels of SOD2 (SOD2ac) were examined using western blotting in cells expressing Flag‐tagged SOD2 after 48 h of transfection with siRNA. The band intensity of SOD2ac was normalized to that of SOD2 and shown as relative to control (Ctr). α‐Tubulin and β‐actin are the loading controls. (E) MCF7 cells were transfected with the indicated siRNAs, and nascent protein synthesis was examined after 24 h (Materials and methods). The affinity‐purified fractions were examined using western blotting with the indicated antibodies. The band intensity of p21 Cip1 was normalized to that of β‐actin and shown as relative to control (Ctr). Representative results from three independent experiments are shown. β‐Actin is the loading control. In western blotting, representative blots from three independent experiments are shown. Bars and plots represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. Two‐tailed Student's t ‐test (A and C) and one‐way ANOVA following by Bonferroni multiple comparisons test among group (B); ** P < 0.01, n.s., not significance.

Techniques: Activity Assay, Western Blot, Quantitative RT-PCR, Transfection, Negative Control, Control, Expressing, shRNA, Cell Culture, Affinity Purification, Standard Deviation, Two Tailed Test

Transcription of p21 Cip1 is suppressed by SIRT7 activity under Complex I activity. (A) Western blotting and qRT‐PCR performed in MCF7 cells after 48 h of transfection with siRNA for SIRT7 or negative control siRNA (Ctr). Values are relative to control (Ctr). Representative blots from three independent experiments are shown. β‐Actin is the loading control. (B–D) MCF7 cells expressing Flag‐tagged SIRT7 (wild‐type, SIRT7 WT; a catalytically inactive mutant, SIRT7 H187Y), or control (Mock) were treated with NDUFV1 (NDU) siRNA or negative control siRNA (Ctr). After 48 h, the mRNA levels of p21 Cip1 were examined by qRT‐PCR (B). Values are relative to control (Mock/Ctr). In (C), the WWP Pst reporter was transfected into cells with the internal control and siRNA, and after 48 h, reporter activities were evaluated as in Fig. . Fold changes normalized to the control (Ctr) are graphed. In (D), ChIP was performed to examine the enrichment of acetyl H3K18 on the p21 Cip1 locus after treatment with siRNA for 30 h. Precipitated DNA was analyzed by qPCR using primers specific to the p21 Cip1 locus (Table ), as indicated in the map. Fold changes are normalized to control (Ctr). TSS, transcription start site. Bars represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. Two‐tailed Student's t ‐test (A) and one‐way ANOVA with Bonferroni's multiple comparisons test among group (B–D); * P < 0.05, ** P < 0.01.

Journal: Molecular Oncology

doi: 10.1002/1878-0261.13808

Figure Lengend Snippet: Transcription of p21 Cip1 is suppressed by SIRT7 activity under Complex I activity. (A) Western blotting and qRT‐PCR performed in MCF7 cells after 48 h of transfection with siRNA for SIRT7 or negative control siRNA (Ctr). Values are relative to control (Ctr). Representative blots from three independent experiments are shown. β‐Actin is the loading control. (B–D) MCF7 cells expressing Flag‐tagged SIRT7 (wild‐type, SIRT7 WT; a catalytically inactive mutant, SIRT7 H187Y), or control (Mock) were treated with NDUFV1 (NDU) siRNA or negative control siRNA (Ctr). After 48 h, the mRNA levels of p21 Cip1 were examined by qRT‐PCR (B). Values are relative to control (Mock/Ctr). In (C), the WWP Pst reporter was transfected into cells with the internal control and siRNA, and after 48 h, reporter activities were evaluated as in Fig. . Fold changes normalized to the control (Ctr) are graphed. In (D), ChIP was performed to examine the enrichment of acetyl H3K18 on the p21 Cip1 locus after treatment with siRNA for 30 h. Precipitated DNA was analyzed by qPCR using primers specific to the p21 Cip1 locus (Table ), as indicated in the map. Fold changes are normalized to control (Ctr). TSS, transcription start site. Bars represent the means ± standard deviation from three independent experiments with measurements in triplicate in each experiment. Two‐tailed Student's t ‐test (A) and one‐way ANOVA with Bonferroni's multiple comparisons test among group (B–D); * P < 0.05, ** P < 0.01.

Techniques: Activity Assay, Western Blot, Quantitative RT-PCR, Transfection, Negative Control, Control, Expressing, Mutagenesis, Standard Deviation, Two Tailed Test

Review

mission shrna library (Millipore)

Structured Review

Images

Related Articles

shRNA:

Knockdown:

other:

Plasmid Preparation:

Similar Products

Image Search Results